Supplementary information supplementary figures

SUPPLEMENTARY INFORMATION
SUPPLEMENTARY FIGURES

Supplementary Figure 1. ^G596RBRAF activates ARAF and structure showing A598 position in the BRAF kinase domain (Related to Figure 1).

A) ARAF kinase activity from COS7 cells expressing empty vector control (EV), ARAF, ^K336MARAF and ^D447AARAF with ^G596RBRAF.

B) Modelling of A598BRAF in the resolved crystal structure of the kinase domain of BRAF. The residue in red highlights A598BRAF, whereas the yellow residue highlights phopho-regulatory residue T599BRAF. The orange highlights the Glycine-Rich loop. Figure produced using PyMOL (www.pymol.org).


Supplementary Figure 2. RAF inhibitors do not induce ARAF binding to oncogenic BRAF but activate ARAF in D04 cells and Braf^-/- MEFs (Related to Figure 3).

A) Western blots for endogenous ARAF, BRAF or CRAF in BRAF (IP: BRAF) or ARAF (IP: ARAF) immunoprecipitates or cell lysates from A375P or WM266.4 cells treated with DMSO (-), Sorafenib (SF; 10M), SB590885 (SB; 0.1M), PD184352 (PD; 1M) for 2hr.

B) Kinase assays. Endogenous kinase activity of ARAF, BRAF or CRAF from D04 cells treated with SB590885 (0.1M) for 2 hours.

C) ARAF kinase activity from ^-/-Araf MEF cells expressing empty vector control (EV), ARAF, ^K336MARAF or ^D447AARAF treated with DMSO (-) or SB590885 (SB; 0.1M) for 2hr.

D) ARAF kinase activity from wild-type MEF (^WTMEF) and ^-/-Braf MEFs treated with DMSO or SB590885 (SB; 0.1M) for 2hr.

E) Western blot for HA-BRAF and total ERK2 in ^-/-Braf MEFs cells expressing HA-tagged wild-type BRAF (BRAF), ^T529NBRAF or empty vector control (EV) treated with DMSO (-) or SB590885 (SB; 0.1M) for 2hr.

Supplementary Figure 3. ARAF depletion does not affect ERK phosphorylation in melanoma cell lines (Related to Figure 4).

A,B) Western blot for ARAF, BRAF, CRAF, phospho-ERK (ppERK) and Erk2 (loading control) in RAS (A; WM1361, MM415, MM485) and BRAF (B; WM266.4, UACC62, SKmel13) mutant melanoma cell lines transfected with three different ARAF (ARAF1, ARAF2, ARAF3 (CAGCUGAGGUGAUCCGUAUUU)) siRNA probes.

Supplementary Experimental Procedures

Buffer	Composition
NP40	50 mM Tris-Cl pH 7.5, 150 mM NaCl, 0.5% (v/v) NP40, 5 mM NaF, 0.2 mM Na3VO4, 5 g/ml aprotinin, 10 g/ml leupeptin
WASH	30 mM Tris-Cl pH 7.5, 0.1 mM EDTA, 0.1% (v/v) Triton X-100, 5 mM NaF, 0.2 mM Na3VO4, 10% (v/v) glycerol, 0.3% (v/v) β-Mercaptoetanol (β-ME), 1 M KCl/0.1 M KCl/ no KCl
MKK	30 mM Tris-Cl pH 7.5, 0.1 mM EDTA, 10 mM MgCl2, 0.1% (v/v) Triton X-100, 5 mM NaF, 0.2 mM Na3VO4, 5 mM ATP, 0.3% (v/v) β-ME, 9 g/ml GST-MEK, 400 g/ml GST-ERK
KILL	30 mM Tris-HCl pH 7.5, 9 mM EDTA, 0.1% (v/v) Triton X-100, 5 mM NaF, 0.2 mM Na3VO4, 0.3% (v/v) β-ME
MBP	50 mM Tris-HCl pH 7.5, 0.1 mM EDTA, 12 mM MgCl2, 0.1% (v/v) Triton X-100, 5 mM NaF, 0.2 mM Na3VO4, 200 g/ml BSA, 1.1 mg/ml MBP, 0.3% (v/v) β-ME, 0.12 MBq [^32P]-ATP (5.55x10^8 MBq/nmol; PerkinElmer)

Supplementary Table 1. Composition of buffers used in this study.
Reagents. For western blot the following antibodies were used: rabbit anti-ARAF (C-20), mouse anti-BRAF (F7), rabbit anti-ERK2 (C-14), rabbit anti-HRAS (F235), rabbit anti-caveolin1 (N-20) from Santa Cruz Biotechnology (Heidelberg, Germany); mouse anti-CRAF from BD Transduction Laboratories (San Jose, USA); mouse anti-ppERK1/2 (M8159), mouse anti-Tubulin (T5168), mouse anti-HA (H3663) from Sigma (St. Louis, U.S.A.); rabbit anti-ppMEK1/2 (9121), mouse anti-myc (9B11) from Cell Signaling (Boston, USA). For immunoprecipitation, the following antibodies were used: rabbit anti-ARAF (4432) from Cell Signaling, goat anti-BRAF (C-19), rabbit anti-CRAF (C-20) from Santa Cruz Biotechnology, rabbit anti-myc (ab9106) from Abcam (Cambridge, United Kingdom), mouse anti-HA (12CA5) from ICR – Hybridoma Unit. SB590885 was obtained from Symansis (Timaru, New Zealand). Sorafenib and PD184352 were synthesised in-house, synthetic routes are available on request. All drugs were prepared in DMSO.
DNA constructs. The expression vector for wild-type human ARAF (pEFm/ARAF.6) was available in the laboratory. The cDNA for ARAF was cloned into pEFPlink.2, a mammalian expression vector derived from pEFBos (1, 2) that uses the elongation factor 1 promoter to direct high levels of expression of cloned cDNAs. The pEFm/ARAF.6 expression vector encodes the ARAF cDNA (2503bp) with a myc-epitope tag (amino acid sequence: EQKLISEEDL) fused to its N-terminus (2). This construct allows the expression of ARAF as a myc-epitope tagged protein. The wild-type human BRAF expression vector, pEFHA/BRAF.8 expression vector was also available in the laboratory and expresses BRAF with a haemagglutinin (HA)-epitope tag sequence (sequence: YPYDVPDYA) at the N-terminus (3). This vector is derived from pEFm/BRAF.6 (4) and encodes the BRAF cDNA (2298bp) containing alternatively spliced exons 1 and 2 but not exons 8b or 10a (5). PCR site-directed mutagenesis was used to generate the following mutants in pEFm/ARAF.8: R52L, G331C, K336M, E439K, D447A, and A451T. The mutants G478C and A598T were generated in pEFHA/BRAF.8.
Cell Culture techniques. Human cell lines were routinely cultured in Dulbecco’s Modified Eagles Medium (DMEM; Invitrogen, Paisley, Scotland) (WM266.4, UACC62, Skmel13 and Mouse Embryonic Fibroblasts (MEF)) or in RPMI 1640 (Invitrogen) (HCT166, D04, MM415, MM485 and WM1361) supplemented with 10% Fetal Bovine Serum (FBS) (GIBCO, Invitrogen) and penicillin (12g/L) and streptomycin (20 g/L). African green monkey kidney COS-7 cells were cultured in DMEM supplemented with 10% FBS. All cells were grown at 37C with 10% CO₂. For inhibitor treatment, the drugs were added to the medium for 2 hours.
DNA Transfection. Transient transfection experiments were performed in COS7 cells using lipofectamine (Invitrogen). 2.2x10⁵ cells were seeded per well on 35 mm culture dishes and incubated overnight. 87.5 to 240.625 ng of expression plasmid DNA (depending on the construct) were mixed with 3 l of lipofectamine in 200 l of serum free media and incubated for 15 minutes at room temperature. Cells were washed twice with serum-free DMEM and then overlaid with 800 l of serum free DMEM. The DNA:lipofectamine mix was added to the wells. After 6 hours of transfection cells were washed twice with normal growth medium and 2 ml of medium supplemented with 10% FBS was added to each well. Cell lysates were prepared two days following transfection. For transient transfection of D04 cells, 4μg of DNA was mixed with 4x10⁶ cells resuspended in 100μl of Nucleofection Solution V in an Amaxa-certified cuvette and transfected using programme T-030 of the Lonza Nucleofector (Lonza, Cologne AG). The cells were re-plated into 100mm diameter tissue culture wells and incubated for 48 hours before preparation of cell extracts. Transient transfection of MEF cells was performed as described for D04 cells but using the programme T-020.
siRNA transfection. Cells were seeded at a density of 2-2.5x10⁵ cells per well in 2 ml of normal growth media, in 35 mm diameter wells. The cells were either mock-transfected or transfected with 5nM of the appropriate siRNA using lipofectamine as described above. D04 cells were plated at a density of 2 x 10⁵ cells per well of 6-well plate and the following day were transfected with lipofectamine and 5 nM of siRNA. The following day cells were split 1:2 and reseeded in 6-well plates. After another 24 hours cells were transfected again with a further 5 nM of each appropriate siRNA. Cells were harvested 24 hours following this second siRNA transfection.
Focus formation assay. NIH3T3 cells were transfected with lipofectamine as described above. After 24 hours, cells were detached from the wells and split between two 100 mm diameter tissue culture wells containing 10 ml of DMEM supplemented with 5% Donor Calf Serum (DCS) (GIBCO). Cells were supplemented with fresh media every 3 days. Focus formation assay was terminated at day 14 for ^G12VHRAS and at day 21 for ARAF, by fixing cells with 4% formaldehyde for 30 min. Foci were stained with 1% (w/v) Crystal violet (Sigma) in 70% ethanol for 1-2 min. Petri dishes were then washed with water and allowed to air dry. Only foci that were visible by eye and greater than 2 mm² were scored. Cells transfected with empty vector control were also included in the experiment to control for spontaneous transformation.

Preparation of cell lysates. Culture medium was aspirated from cells and these were washed twice with cold PBS1x and placed on ice. Depending on the cell confluence, cells were scraped into 50-200 l of Nonidet P40 (NP40) extraction buffer (Table S1) and incubated on ice for five minutes. Cell extracts were centrifuged at 13000 rpm for 10 minutes at 4C and the soluble fraction was collected.
Co-immunoprecipitation. Co-immunoprecipitations were performed between differentially tagged RAF proteins as well as for the endogenous proteins. 10-15% of the protein cell lysate was used to control for levels of expression and the remaining sample was used for immunoprecipitation. Myc-tagged ARAF, BRAF and CRAF were immunoprecipitated using 2 g of ab9106 anti-myc antibody. Endogenous ARAF immunoprecipitation was performed using a 1:50 dilution of 4432 anti-ARAF antibody. BRAF was immunoprecipitated using 5 g of 12CA5 antibody against the HA-tag or using 5 g of C-19 antibody. Endogenous CRAF was immunoprecipitated using 5 g of C-20 antibody. Protein:antibody complexes were captured by 20 l of a 1:1 mixture of G-agarose beads (Pierce, Rockford, U.S.A.) and NP40 buffer. Immunoprecipitates were mixed for 2-4 hours at 4C, on a rotation wheel. Immumoprecipitates were washed 3x with 300 l of cold NP40 buffer and mixed with 30 l of 2x sample buffer. Samples were denatured, analysed by sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) and Western-blotted. Specific bands were detected using fluorescent-labelled secondary antibodies (Invitrogen; Li-COR Biosciences) and analyzed using an Odyssey Infrared Scanner (Li-COR Biosciences).
Cell fractionation. COS7 cells were transfected as described previously. 48 hours after transfection, cells were washed 3x in cold PBS1x and once in HEPES 20 mM pH7.4 buffer. Each well was harvested in 200 l of cold HEPES 20 mM pH7.4 buffer. Cell membranes were disrupted by passing the lysates 10 times through 9G and then 19G syringe needles (Thermo Medical). Lysates were centrifuged at 3000 rpm for 5 min to obtain the nuclear fraction (pellet) and the non-nuclear fraction. 100 l of total lysate were set aside for further analysis and the remaining sample was centrifuged for 30 min at 100000 g to separate the cytosolic (supernatant) from the membrane fraction (pellet). The supernatant was transferred to a new 1.5 ml tube and the pellet was resuspended in 200 μl of 20 mM HEPES pH7.4/1% Triton-X-100, supplemented with protease inhibitors. For analysis by SDS-PAGE, protein concentration was determined by Bradford protein assay (Bio-Rad Laboratories, Germany) using purified bovine serum albumin (BSA) as the standard according to manufacturer’s instructions. Equal amounts of protein were analysed for the cytosolic fraction, the membrane fraction and the total cell lysate.
Kinase assays. The in vitro kinase activity of RAF proteins was measured using a coupled kinase cascade assay with GST-MEK, GST-ERK and myelin basic protein (MBP) (Sigma-Aldrich) as sequential substrates. ERK activation is quantified by measuring the incorporation of [³²P]-orthophosphate (PerkinElmer) into MBP. For measurement of RAF endogenous kinase activity, cells were seeded in 100 mm diameter tissue culture wells and collected in 500 l of NP40 buffer. Protein concentration was determined and equal amounts of protein were immunoprecipitated using RAF specific antibodies. For measurement of ARAF or BRAF mutant kinase activity, cells were transiently transfected in 35 mm diameter cell culture dishes with myc and/or HA-tag RAF and harvested in 200 l of NP40 buffer. Equivalent amounts of RAF protein were immunoprecipitated as described above. Immunoprecipitates were washed sequentially with 300 l of cold wash buffer containing decreasing concentrations of salt (1M KCl, 0.1M KCl and no salt) (Table S1). The first step reaction was initiated by addition of 20 l of MKK buffer (Table S1) to the beads and incubation for 30 min at 30C. The reaction was terminated by addition of 20 l of Kill buffer to the samples (Table S1). The reaction supernatants were collected from the beads and transferred to new tubes. For the second reaction, 5 l of activated ERK was incubated with 25 l of MBP buffer (Table S1) for 10 minutes at 30C in triplicate to measure ERK activity. The second reaction was terminated by spotting 20 l of reaction mixture into squares of P81 paper and immersing them in 75 mM orthophosphoric acid. P81 paper is negatively charged; under acidic conditions MBP is positively charged, so MBP will bind strongly to the paper. The P81 squares were washed 3x in 75 mM orthophosphoric acid and ERK activity was quantified by measuring the incorporation of [³²P] orthophosphate into MBP using Cerenkov counting. The background activity was measured using lysates transfected with the empty vector and the upper limit of each assay was determined using a saturating control, usually ^V600EBRAF purified protein. All in vitro kinase activities presented here have been corrected for the background activity of the assay.
Supplemental References

1. Marais R, Light Y, Paterson HF, Marshall CJ. Ras recruits Raf-1 to the plasma membrane for activation by tyrosine phosphorylation. Embo J. 1995 Jul 3;14(13):3136-45.

2. Mizushima S, Nagata S. pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res. 1990 Sep 11;18(17):5322.

3. Wadzinski BE, Eisfelder BJ, Peruski LF, Jr., Mumby MC, Johnson GL. NH2-terminal modification of the phosphatase 2A catalytic subunit allows functional expression in mammalian cells. J Biol Chem. 1992 Aug 25;267(24):16883-8.

4. Mason CS, Springer CJ, Cooper RG, Superti-Furga G, Marshall CJ, Marais R. Serine and tyrosine phosphorylations cooperate in Raf-1, but not B-Raf activation. Embo J. 1999 Apr 15;18(8):2137-48.

5. Barnier JV, Papin C, Eychene A, Lecoq O, Calothy G. The mouse B-raf gene encodes multiple protein isoforms with tissue-specific expression. J Biol Chem. 1995 Oct 6;270(40):23381-9.