A
NTIMICROBIAL
A
GENTS AND
C
HEMOTHERAPY
, July 2005, p. 3097–3098
Vol. 49, No. 7
0066-4804/05/$08.00
ϩ0 doi:10.1128/AAC.49.7.3097–3098.2005
Copyright © 2005, American Society for Microbiology. All Rights Reserved.
One New LEN Enzyme and Two New OKP Enzymes in Klebsiella pneumoniae
Clinical Isolates and Proposed Nomenclature for Chromosomal
-Lactamases of This Species
Three families of chromosomally encoded beta-lactamases
have been identified so far in Klebsiella pneumoniae clinical
isolates: SHV (7), LEN (1), and very recently, OKP (5). These
enzymes are closely related to OHIO-1 (10). We determined
the sequences of the bla genes of nine isolates of K. pneu-
moniae producing a penicillinase with an isoelectric point dif-
ferent from 7.6, the pI of the most commonly encountered
SHV-1 (6). The strains were susceptible to cephalosporins
(except for one isolate that also produced CTX-M-3). The bla
gene was amplified with primers Pro3-F (9) and Gra2-R (8).
FIG. 1. Alignment of the amino acid sequences of OKP-1, OKP-2, OKP-3, OKP-4 (truncated sequences) (5), OKP-5, and OKP-6 (this study).
The amino acid position is shown above the sequence. The consensus sequence (C) is shown below the other sequences. In the consensus sequence,
asterisks indicate positions of amino acid substitutions. Gaps introduced to maximize alignment are indicated by dashes.
3097
on May 24, 2018 by guest
http://aac.asm.org/
Downloaded from
Sequencing of the entire
bla gene was performed with the use
of additional primers: P1-F (2), P1-Rev (CAAGGTGTTTTT
CGCTGA), and P3-F (CCACTACCCCGGCCAGCATG)
(this study). Primers Pro3-F, Gra2-R, P1-F, P1-Rev, and P3-F
were located at positions 132 to 151, 1060 to 1041, 509 to 526,
526 to 509, and 725 to 744 of bla
SHV-1
(GenBank accession
number AF124984), respectively. A new
bla
LEN
gene and two
new bla
OKP
genes were detected. The bla
LEN
variant (Gen-
Bank accession number AY743416) encoded a novel enzyme,
LEN-10 (pI between 7.1 and 7.2), which differed from LEN-2
by three amino acids: Asp24Tyr, Val88Leu, and Val114Thr.
The OKP-5 and OKP-6 beta-lactamases had a pI of 7.1
(GenBank accession number AY512506 for bla
OKP-5
and
AY850171 for bla
OKP-6
). Figure 1 showed the alignment of the
amino acid sequences of the OKP enzymes. Like the other
members of the family, OKP-5 and OKP-6 differed from
SHV-1 and LEN-1 by 27 to 33 amino acids. It is noteworthy
that three substitutions occurred within the first 16 amino
acids. Unfortunately, this region was not sequenced in the case
of the four OKP variants described so far, because the primers
used by the authors do not encompass the beginning of the
sequence of the bla gene (5).
Our results confirm the diversity of class A chromosomal
beta-lactamase genes among K. pneumoniae isolates. Haegg-
man et al. noticed in their study that the pIs of the OKP
beta-lactamases (7.8, 8.1, 7.0, and 6.5) are different from the
pIs of the chromosomal SHV (7.6) and LEN (7.1) enzymes and
therefore proposed using the pI as the first tool to identify the
beta-lactamase family of K. pneumoniae (5). The new LEN-10
enzyme had a pI somewhat different from 7.1, indicating the
possibility of variation in the pIs among the members of this
family. Moreover, OKP-5 and OKP-6 had a pI of 7.1, identical
to that of multiple LEN variants. These two observations un-
dermine the proposal of Haeggman et al.
We propose grouping the LEN and the OKP enzymes in a
single new family “K. pneumoniae-specific chromosomal
-lac-
tamases,” excluding SHV on the basis of the following major
observations. (i) LEN and OKP enzymes have been character-
ized only in K. pneumoniae isolates, unlike SHV-1. (ii) The
bla
LEN
and
bla
OKP
genes are chromosomally located, whereas
bla
SHV-1
is sometimes carried by a plasmid (3, 4). (iii) LEN and
OKP have been unable to evolve the ability to hydrolyze ex-
tended-spectrum cephalosporins.
In conclusion, this work pointed out the necessity of obtain-
ing the complete sequence of the bla gene with the appropriate
primers to identify the phylogenic group of a K. pneumoniae
chromosomal beta-lactamase.
REFERENCES
1. Arakawa, Y., M. Ohta, N. Kido, Y. Fujii, T. Komatsu, and N. Kato. 1986.
Close evolutionary relationship between the chromosomally encoded
-lac-
tamase gene of
Klebsiella pneumoniae and the TEM
-lactamase gene me-
diated by R plasmids. FEBS Lett. 207:69–74.
2. Babini, G. S., and D. M. Livermore. 2000. Are SHV
-lactamases universal
in Klebsiella pneumoniae? Antimicrob. Agents Chemother. 44:2230.
3. Bradford, P. A. 2001. Extended-spectrum
-lactamases in the 21st century:
characterization, epidemiology, and detection of this important resistance
threat. Clin. Microbiol. Rev. 14:933–951.
4. Bush, K., G. A. Jacoby, and A. A. Medeiros. 1995. A functional classification
scheme for
-lactamases and its correlation with molecular structure. Anti-
microb. Agents Chemother. 39:1211–1233.
5. Haeggman, S., S. Lofdahl, A. Paauw, J. Verhoef, and S. Brisse. 2004. Diver-
sity and evolution of the class A chromosomal
-lactamase gene in Klebsiella
pneumoniae. Antimicrob. Agents Chemother. 48:2400–2408.
6. Labia, R., M. Barthelemy, and J. M. Masson. 1976. Multiplicity of
-lacta-
mases: a problem of isoenzymes. C. R. Acad. Sci. D 283:1597–1600.
7. Mercier, J., and R. C. Levesque. 1990. Cloning of SHV-2, OHIO-1, and
OXA-6
-lactamases and cloning and sequencing of SHV-1 -lactamase.
Antimicrob. Agents Chemother. 34:1577–1583.
8. Rasheed, J. K., G. J. Anderson, H. Yigit, A. M. Queenan, A. Domenech-
Sanchez, J. M. Swenson, J. W. Biddle, M. J. Ferraro, G. A. Jacoby, and F. C.
Tenover.
2000. Characterization of the extended-spectrum
-lactamase ref-
erence strain, Klebsiella pneumoniae K6 (ATCC 700603), which produces the
novel enzyme SHV-18. Antimicrob. Agents Chemother. 44:2382–2388.
9. Rice, L. B., L. L. Carias, A. M. Hujer, M. Bonafede, R. Hutton, C. Hoyen, and
R. A. Bonomo.
2000. High-level expression of chromosomally encoded
SHV-1
-lactamase and an outer membrane protein change confer resis-
tance to ceftazidime and piperacillin-tazobactam in a clinical isolate of
Kleb-
siella pneumoniae. Antimicrob. Agents Chemother.
44:362–367.
10. Shlaes, D. M., C. Currie-McCumber, A. Hull, I. Behlau, and M. Kron. 1990.
OHIO-1
-lactamase is part of the SHV-1 family. Antimicrob. Agents Che-
mother.
34:1570–1576.
Eliane Siebor
Andre
´ Pe
´chinot
Jean-Marie Duez
Catherine Neuwirth
*
Laboratoire de Bacte´riologie
Ho
ˆpital Universitaire du Bocage
BP 77908
21079 Dijon Cedex, France
*Phone: 33-3 80 29 32 60
Fax: 33-3 80 29 36 67
E-mail: catherine.neuwirth@chu-dijon.fr
3098
LETTERS TO THE EDITOR
A
NTIMICROB
. A
GENTS
C
HEMOTHER
.
on May 24, 2018 by guest
http://aac.asm.org/
Downloaded from